Research and Publication Ethics: The research was done in accordance to the ethical principles and the national norms and standards for conducting Medical Research in Iran and received the approval ID from Research Ethics Commitees of Amol University of Special Modern Technlogies: IR.AUSMT.REC.1401.001.
Sample Collection: A total of 68 cloacal swabs were carefully collected from apparently healthy caged birds including pigeon (Columba livia) (n=44), chicken (Gallus gallus) (n=10), lovebird (Agapornis roseicollis) (n=8), and canary (Serinus canaria) (n=6) in Mazandaran province in Iran. Immediately after collection, each sample was inoculated into the sterile nutrient broth (NB) and kept in the ice box, and transported to the Bacteriology Laboratory of the Faculty of Veterinary Medicine, Amol University of Special Modern Technologies.
DNA Extraction: Genomic DNA from cloacal samples was isolated using a stool DNA extraction kit (Bioneer, Daejeon, South Korea) according to the producer endorsements with some adjustments. Concisely, 100 mg of each sample was mixed with 20 μL proteinase K and 100 μL lysis buffer and incubated for 10 min at 55 °C. After centrifugation of the mixture at 13000 rpm, the supernatant was mixed with 200 μL binding solution in a new tube and incubated again for 10 min at 60 °C. After incubation, 100 μL isopropanol was added to the tube and then the liquid was transferred into the binding column and centrifuged for 1 min at 8000 rpm. This step was repeated using 500 μl for both washing buffers 1 and 2; then, DNA was precipitated using 100 μL elution buffer and centrifugation at 13000 rpm for 1 min. Extracted DNA was kept at -20 °C until using in PCR.
PCR Assay: Two universal oligonucleotide primers including forward primer with the sequence of `5- CGGTGGGTACTAGGTGTGGGTTTC -3` and reverse primer with the sequence of `5- CTGCGATTACTAGCGACTCCGACTTCA -3` previously described for Mycobacterium species were used to amplify the partial 16S rRNA locus 8. The PCR reaction mixtures consisted of 100 ng DNA template, 2.5 μl 10x PCR buffer (75 mM Tris-HCl, pH 9.0, 2 mM MgCl2, 50 mM KCl, 20 mM (NH4)2SO4; Bioneer, Daejeon, South Korea), 0.2 mM dNTPs (Bioneer, Daejeon, South Korea), 1.5 U AmpliTaq DNA polymerase (Bioneer, Daejeon, South Korea), and 10 pmol each primer (Takapouzist, Tehran, Iran). The volume of the reaction mixture was completed to 25 μl using distilled deionized water. The thermal cycler (MJ mini, BioRad, USA) was adjusted under optimum conditions. Briefly, Initial denaturation at 94°C for 4 min, followed by 33 cycles of denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 1 min. The final extension was carried out at 72°C for 7 min. Amplified products, with 543 bp length, were separated by electrophoresis in 1.5% agarose gel electrophoresis stained with ethidium bromide (Cinacolon, Tehran, Iran). The 100 bp DNA ladder was used as a molecular size marker.
Sequencing and Phylogenetic Analysis: PCR products of the positive samples with the specific suspected bands for primers were subjected to sequencing (Takapuzist Co., Iran). The sequencing results were submitted, analyzed, and compared to the GenBank databases using the BLAST program maintained by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). In addition, multiple sequence alignments were made by the ClustalW method, using MEGA7 software and the phylogenetic tree was drawn using the Bootstrap method with 1000 replications 9.
)
)
)
